pcr amplicon Search Results


97
Genecopoeia nilehifi long amplicon pcr kit
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Nilehifi Long Amplicon Pcr Kit, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nilehifi long amplicon pcr kit/product/Genecopoeia
Average 97 stars, based on 1 article reviews
nilehifi long amplicon pcr kit - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

97
Qiagen pcr amplicons
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Pcr Amplicons, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplicons/product/Qiagen
Average 97 stars, based on 1 article reviews
pcr amplicons - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

96
Eppendorf AG rt pcr amplicon tubes
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Rt Pcr Amplicon Tubes, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt pcr amplicon tubes/product/Eppendorf AG
Average 96 stars, based on 1 article reviews
rt pcr amplicon tubes - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Illumina Inc pcr amplicons sequenced via multiplexed, paired-end illumina miseq tag sequencing
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Pcr Amplicons Sequenced Via Multiplexed, Paired End Illumina Miseq Tag Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplicons sequenced via multiplexed, paired-end illumina miseq tag sequencing/product/Illumina Inc
Average 90 stars, based on 1 article reviews
pcr amplicons sequenced via multiplexed, paired-end illumina miseq tag sequencing - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc polymerase chain reaction (pcr) amplicons
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Polymerase Chain Reaction (Pcr) Amplicons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polymerase chain reaction (pcr) amplicons/product/Illumina Inc
Average 90 stars, based on 1 article reviews
polymerase chain reaction (pcr) amplicons - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc pcr amplicons
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Pcr Amplicons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplicons/product/Illumina Inc
Average 90 stars, based on 1 article reviews
pcr amplicons - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc 16s amplicon pcr reverse primer
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
16s Amplicon Pcr Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s amplicon pcr reverse primer/product/Illumina Inc
Average 90 stars, based on 1 article reviews
16s amplicon pcr reverse primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Beijing Genomics Institute Shenzhen amplified fragments
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Amplified Fragments, supplied by Beijing Genomics Institute Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amplified fragments/product/Beijing Genomics Institute Shenzhen
Average 90 stars, based on 1 article reviews
amplified fragments - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc fusion pcr amplicon
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Fusion Pcr Amplicon, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fusion pcr amplicon/product/Illumina Inc
Average 90 stars, based on 1 article reviews
fusion pcr amplicon - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Oxford Nanopore pcr amplicon sequencing on the oxford-nanopore minion platform
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
Pcr Amplicon Sequencing On The Oxford Nanopore Minion Platform, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr amplicon sequencing on the oxford-nanopore minion platform/product/Oxford Nanopore
Average 90 stars, based on 1 article reviews
pcr amplicon sequencing on the oxford-nanopore minion platform - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc 2-step pcr amplicon library preparation and sequencing on an illumina platform
A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, <t>amplicon</t> library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.
2 Step Pcr Amplicon Library Preparation And Sequencing On An Illumina Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2-step pcr amplicon library preparation and sequencing on an illumina platform/product/Illumina Inc
Average 90 stars, based on 1 article reviews
2-step pcr amplicon library preparation and sequencing on an illumina platform - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Illumina Inc round two amplicon pcr primer

Round Two Amplicon Pcr Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/round two amplicon pcr primer/product/Illumina Inc
Average 90 stars, based on 1 article reviews
round two amplicon pcr primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, amplicon library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.

Journal: bioRxiv

Article Title: GREPore-seq: A Robust Workflow to Detect Changes after Gene Editing through Long-range PCR and Nanopore Sequencing

doi: 10.1101/2021.12.13.472514

Figure Lengend Snippet: A , Step 1, Laboratory process of cell culture, nucleofection, and gDNA extraction. B , Step 2, amplicon library preparation, and nanopore sequencing. C , Step 3, GREPore-seq bioinformatic analysis.

Article Snippet: To evaluate the performance of KAPA HiFi DNA Polymerase (Kapa Biosystems), NileHiFi Long Amplicon PCR Kit (GeneCopoeia), and PrimeSTAR, each of the three long-range PCR enzymes was used to amplify the same wild-type genomic DNA sample.

Techniques: Cell Culture, Extraction, Amplification, Nanopore Sequencing

A , Comparison of three DNA polymerase kits. The quality and quantity of PCR products were assessed by electrophoresis on agarose gels. Specific primers (without barcode) for seven sites were used to amplify wild-type targets, each with two technical replicates. Red cross, failed amplification; red frames, expected products ( AAVS1 , 3928 bp; B2M , 5666 bp; BCL11A-1 , 8159 bp; BCL11A-2 , 8443 bp; EEF2 , 5287 bp; TRAC , 6485 bp; TRBC , 5093 bp). B , The PCR success rates of PrimeSTAR, KAPA HiFi, and NileHiFi among 135 reactions. C , Removal of adaptors with Porechop. We used the command “seqkit locate -p” and the barcode “AACGGACT” (for BCL11A-3 primer-F) to detect the start location after Guppy or Porechop trimming. The two peaks in blue indicate nanopore sequencing adaptors. D , Distribution of nanopore raw read lengths before Porechop trimming. E , Distribution of nanopore read lengths after Porechop trimming. The read numbers % were normalized to raw reads before Porechop processing. F , Strategy for retrieving full-length amplicon reads. A schematic of the Grepseq-left and Grepseq-right generations is shown. Visualization of retrieved BCL11A-3 amplicon reads with IGV after sampling 200 reads using the command “seqkit sample 200”. G , Distribution of nanopore read lengths after extracting the BCL11A-3 PCR product (3863 bp) by GERPore-seq. The read numbers % were normalized to raw reads before trimming.

Journal: bioRxiv

Article Title: GREPore-seq: A Robust Workflow to Detect Changes after Gene Editing through Long-range PCR and Nanopore Sequencing

doi: 10.1101/2021.12.13.472514

Figure Lengend Snippet: A , Comparison of three DNA polymerase kits. The quality and quantity of PCR products were assessed by electrophoresis on agarose gels. Specific primers (without barcode) for seven sites were used to amplify wild-type targets, each with two technical replicates. Red cross, failed amplification; red frames, expected products ( AAVS1 , 3928 bp; B2M , 5666 bp; BCL11A-1 , 8159 bp; BCL11A-2 , 8443 bp; EEF2 , 5287 bp; TRAC , 6485 bp; TRBC , 5093 bp). B , The PCR success rates of PrimeSTAR, KAPA HiFi, and NileHiFi among 135 reactions. C , Removal of adaptors with Porechop. We used the command “seqkit locate -p” and the barcode “AACGGACT” (for BCL11A-3 primer-F) to detect the start location after Guppy or Porechop trimming. The two peaks in blue indicate nanopore sequencing adaptors. D , Distribution of nanopore raw read lengths before Porechop trimming. E , Distribution of nanopore read lengths after Porechop trimming. The read numbers % were normalized to raw reads before Porechop processing. F , Strategy for retrieving full-length amplicon reads. A schematic of the Grepseq-left and Grepseq-right generations is shown. Visualization of retrieved BCL11A-3 amplicon reads with IGV after sampling 200 reads using the command “seqkit sample 200”. G , Distribution of nanopore read lengths after extracting the BCL11A-3 PCR product (3863 bp) by GERPore-seq. The read numbers % were normalized to raw reads before trimming.

Article Snippet: To evaluate the performance of KAPA HiFi DNA Polymerase (Kapa Biosystems), NileHiFi Long Amplicon PCR Kit (GeneCopoeia), and PrimeSTAR, each of the three long-range PCR enzymes was used to amplify the same wild-type genomic DNA sample.

Techniques: Comparison, Electrophoresis, Amplification, Nanopore Sequencing, Sampling

A , A schematic overview of Grepseqs and extraction for three distinct target reads. Bases and “-” that are marked in red indicate the mismatches aligned between the reference and a nanopore read. B , Preprocessing with Barcode_splitter decreases the data recovery rate. Data were normalized to GREPore-seq alone. The sequence of 4 or 5 nt at the beginning was used in Barcode_splitter. 20:90 or 20:150 represents the range of Grepseqs used for amplicon-specific read extraction. C , Low misassignment of amplicon reads by GREPore-seq. The data in B were statistically analyzed by two-way ANOVA. Adjusted P values were indicated.

Journal: bioRxiv

Article Title: GREPore-seq: A Robust Workflow to Detect Changes after Gene Editing through Long-range PCR and Nanopore Sequencing

doi: 10.1101/2021.12.13.472514

Figure Lengend Snippet: A , A schematic overview of Grepseqs and extraction for three distinct target reads. Bases and “-” that are marked in red indicate the mismatches aligned between the reference and a nanopore read. B , Preprocessing with Barcode_splitter decreases the data recovery rate. Data were normalized to GREPore-seq alone. The sequence of 4 or 5 nt at the beginning was used in Barcode_splitter. 20:90 or 20:150 represents the range of Grepseqs used for amplicon-specific read extraction. C , Low misassignment of amplicon reads by GREPore-seq. The data in B were statistically analyzed by two-way ANOVA. Adjusted P values were indicated.

Article Snippet: To evaluate the performance of KAPA HiFi DNA Polymerase (Kapa Biosystems), NileHiFi Long Amplicon PCR Kit (GeneCopoeia), and PrimeSTAR, each of the three long-range PCR enzymes was used to amplify the same wild-type genomic DNA sample.

Techniques: Extraction, Sequencing, Amplification

A , Top: A schematic overview of dsODN 29 bp insertions at DSBs with Cas9-gRNA RNP gene editing and generation of DSgrep-seqs for retrieving reads with the insert. Bottom: Visualization of WT- or dsODN-amplicon reads and amplification of insertion details of dsODN data. Bases marked in red and blue indicate forward and reverse dsODN insertions; dark-red bases indicate recurring alignment; bases and “-” marked in dark indicate mismatches aligned between 29 nt dsODN and a nanopore read. BC , Effects of DSgrep-seq lengths and step values on retrieval rate (B) and FDR (C) of reads with dsODN. Editing without dsODN serves as a control to determine the false retrieval rate (C). Error bars represent the mean ± SEM of n = 24 - 26 independent experiments. DE , Step values ranging from 1 to 5 moderately affect the data recovery rate (D) and FDR (E). F , dsODN insertion rates were analyzed by three methods. G - I , dsODN retrieval rates analyzed by CRISPREsso2, GrepNGS, and GREPore-seq from data in B and D are highly correlated. The data in B-F were statistically analyzed by two-way ANOVA. Adjusted P values were indicated. “ns” means no significance ( p > 0.05).

Journal: bioRxiv

Article Title: GREPore-seq: A Robust Workflow to Detect Changes after Gene Editing through Long-range PCR and Nanopore Sequencing

doi: 10.1101/2021.12.13.472514

Figure Lengend Snippet: A , Top: A schematic overview of dsODN 29 bp insertions at DSBs with Cas9-gRNA RNP gene editing and generation of DSgrep-seqs for retrieving reads with the insert. Bottom: Visualization of WT- or dsODN-amplicon reads and amplification of insertion details of dsODN data. Bases marked in red and blue indicate forward and reverse dsODN insertions; dark-red bases indicate recurring alignment; bases and “-” marked in dark indicate mismatches aligned between 29 nt dsODN and a nanopore read. BC , Effects of DSgrep-seq lengths and step values on retrieval rate (B) and FDR (C) of reads with dsODN. Editing without dsODN serves as a control to determine the false retrieval rate (C). Error bars represent the mean ± SEM of n = 24 - 26 independent experiments. DE , Step values ranging from 1 to 5 moderately affect the data recovery rate (D) and FDR (E). F , dsODN insertion rates were analyzed by three methods. G - I , dsODN retrieval rates analyzed by CRISPREsso2, GrepNGS, and GREPore-seq from data in B and D are highly correlated. The data in B-F were statistically analyzed by two-way ANOVA. Adjusted P values were indicated. “ns” means no significance ( p > 0.05).

Article Snippet: To evaluate the performance of KAPA HiFi DNA Polymerase (Kapa Biosystems), NileHiFi Long Amplicon PCR Kit (GeneCopoeia), and PrimeSTAR, each of the three long-range PCR enzymes was used to amplify the same wild-type genomic DNA sample.

Techniques: Amplification, Control

Journal: eLife

Article Title: Structurally distributed surface sites tune allosteric regulation

doi: 10.7554/eLife.68346

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , D710 , Illumina/Reynolds et al. Cell 2011 [20] , Round two Amplicon PCR primer , caagcagaagacggcatacgagatttcgcggagtgactggagttcagacgtg.

Techniques: Recombinant, Selection, Plasmid Preparation, Expressing, Sequencing, Amplification, Mutagenesis, Software